Top » Catalog » R1b » S768

$18.00

S768
[S768]

S768
HG19 Position: ChrY:14845275..14845275
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1i1 (not listed)
Comments: Downstream of L745 / S781
Forward Primer: S768_F GGCTACACATCGGTTTTGTG
Reverse Primer: S768_R CACAGTAAATGAAACTGCAGAATG
Reviews (1)

Customers who bought this product also purchased
A5023
A5023
S310
S310
Y14198
Y14198
L746
L746
MC21
MC21
BY114
BY114
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies