Top » Catalog » R1b » S768

$18.00

S768
[S768]

S768
HG19 Position: ChrY:16957155..16957155
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1i1 (not listed)
Comments: Downstream of L745 / S781
Forward Primer: S768_F GGCTACACATCGGTTTTGTG
Reverse Primer: S768_R CACAGTAAATGAAACTGCAGAATG
Reviews (1)

Customers who bought this product also purchased
S310
S310
A5023
A5023
Y14198
Y14198
A40
A40
S775
S775
S781
S781
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies